| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.046844 |
| Chromosome: | chromosome 4 |
| Location: | 1109649 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g216050 | (1 of 3) PF08263//PF13855 - Leucine rich repeat N-terminal domain (LRRNT_2) // Leucine rich repeat (LRR_8) | CDS | |
| lncRNA_TCONS_00184340 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATGTGGGATGGGAGAGCAGTGCAGACGCCAGTGCTGTAGAATGCAGG |
| Internal bar code: | ATCCGATAGTTCAACGTGCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4397 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGCCTTTCACACAAAAGCG |
| Suggested primer 2: | CGGAGGCTGCTCAGTCATAG |