Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.046859 |
Chromosome: | chromosome 5 |
Location: | 2303491 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g238250 | BLZ2,BZIP1 | (1 of 1) K04450 - cyclic AMP-dependent transcription factor ATF-2 (ATF2, CREBP1); Basic leucine zipper1 transcription factor | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCAAACAAAAACAAGCGATCACATGGGTTAGCGGTGGTTTGTGGGGGGA |
Internal bar code: | TAGCTTGGACGTATTTGTTAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 933 |
LEAP-Seq percent confirming: | 94.1176 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTTTGAGTGTGACGCCTCC |
Suggested primer 2: | GCGTGAAGGTGACTGGTGTA |