| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.046880 |
| Chromosome: | chromosome 15 |
| Location: | 2189407 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g801755 | (1 of 2) PF00665//PF07727//PF13976 - Integrase core domain (rve) // Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_2) // GAG-pre-integrase domain (gag_pre-integrs) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCTCCCCCAGCTCCCGCACCTTGAAGCACCCGTTGATGGCGGCCTTC |
| Internal bar code: | ACGCAGTGTCTGCATAAGATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1070 |
| LEAP-Seq percent confirming: | 30.4348 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGAACTGTGGATGCAGCT |
| Suggested primer 2: | CTTTTATGCCACGCCCATCG |