| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.046893 |
| Chromosome: | chromosome 3 |
| Location: | 1845586 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g154425 | CLASP,CLASP1 | (1 of 1) K16578 - CLIP-associating protein 1/2 (CLASP1_2); CLIP-associating-protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTAGTCTACATATCCATGTGTGCTACGTTACTTGCCATCCACGCTGC |
| Internal bar code: | AGCTTGTTATGGACGCGAAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1278 |
| LEAP-Seq percent confirming: | 52.9412 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGTGCGGAAGGTGTTTG |
| Suggested primer 2: | GTGGCGCACAAGACTTTACG |