| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.046902 |
| Chromosome: | chromosome 15 |
| Location: | 1653536 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre19.g750747 | NCL38,OPR110 | Nuclear Control of chloroplast Like 38; (1 of 1) IPR011632//IPR013584//IPR016024 - Domain of unknown function DUF1601 // RAP domain // Armadillo-type fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTGGCGGCATCAGCGGCAGCCGCAGTAGCAGTGACGGTGGCGAAAGGG |
| Internal bar code: | GAAGGGTTTGTCGAGTAAATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3421 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGTGTGTTGTTGATGCTG |
| Suggested primer 2: | CCCCCTTCCAATGCAATCCT |