| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.046929 |
| Chromosome: | chromosome 8 |
| Location: | 4109904 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g383300 | Cre10.g429000; (1 of 2) PTHR12668//PTHR12668:SF5 - TRANSMEMBRANE PROTEIN 14, 15 // UPF0136 MEMBRANE PROTEIN YJR085C | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACACACGCCGGCCTAACAACAGCGCTGTCGCCTATAGGGCATTAACGA |
| Internal bar code: | GTCTCGTCTATGAGGGCATAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 212 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGTGGGTAGGGTAGGGCA |
| Suggested primer 2: | AGTGAAACGGACAGTCGCAT |