| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.046963 |
| Chromosome: | chromosome 14 |
| Location: | 2144903 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g621800 | GT90-27,GT90F27 | GT90 family protein 27; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAAAAGCTGTGCGGGCAGGTAGAGTCGACGGTCCACGCCGACGAGTGG |
| Internal bar code: | TAATTGCGCCACCTCCGGTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3110 |
| LEAP-Seq percent confirming: | 89.0625 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTACTGGTAAGCGCAATGC |
| Suggested primer 2: | GGACTTGAGGTGACGAAGGG |