| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.046964 |
| Chromosome: | chromosome 1 |
| Location: | 1635821 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g008891 | (1 of 2) 2.8.1.1//2.8.1.2 - Thiosulfate sulfurtransferase / Thiosulfate thiotransferase // 3-mercaptopyruvate sulfurtransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCGTGAGGGGCGGCGCGGGTGGCGGACTGATGGCATGCCTGGCGGGAT |
| Internal bar code: | AATTATGCACCAATCTTTTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2521 |
| LEAP-Seq percent confirming: | 82.0896 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGCATGAGGACAGTGTG |
| Suggested primer 2: | CCCCGTCATCACCACTATCG |