| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.046967 |
| Chromosome: | chromosome 7 |
| Location: | 1178034 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g321150 | CYG15 | Adenylate/guanylate cyclase, nitric oxide sensing; (1 of 5) K12319 - guanylate cyclase soluble subunit beta (GUCY1B) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCGGGCTGGGTGTCGTCGTGCCCCTACCCCGACGCCGCCACCTACGG |
| Internal bar code: | TCGTTGGTGAGATGAGGTGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5086 |
| LEAP-Seq percent confirming: | 91.4286 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTGTCATGTCAGTCCGTG |
| Suggested primer 2: | GCACCCGATTACCTCCCAAA |