| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.047042 |
| Chromosome: | chromosome 3 |
| Location: | 7803118 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203100 | (1 of 1) IPR000253//IPR027417 - Forkhead-associated (FHA) domain // P-loop containing nucleoside triphosphate hydrolase | 5'UTR | |
| Cre03.g203150 | (1 of 33) IPR013763 - Cyclin-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTGGAGGACAAGCTGGGGCGGGAGACGTACGGCAAGCTGCTGTTGGGG |
| Internal bar code: | CAAGACGGCGTTAATGCCTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 583 |
| LEAP-Seq percent confirming: | 76.4706 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACATACGTCGGCCTAGTG |
| Suggested primer 2: | GAACAGCAACAGCAACAGCA |