Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.047055 |
Chromosome: | chromosome 5 |
Location: | 3429732 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g233304 | CHI3 | (1 of 2) K01183 - chitinase (E3.2.1.14); Chitinase-like hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTGATGCCCCGCATGTGCCAGGCCAATGCCAATACCCTGGAGACTGC |
Internal bar code: | GCTCTGGTCTAGATCTGTGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 920 |
LEAP-Seq percent confirming: | 91.6667 |
LEAP-Seq n confirming: | 22 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCATAGGATCTCCCACTGCC |
Suggested primer 2: | GGCCTAGTGCAATGGGTGAT |