| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.047096 |
| Chromosome: | chromosome 2 |
| Location: | 2977920 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095350 | DNK1,CGL116 | Conserved in the Green Lineage; (1 of 1) PTHR10513 - DEOXYNUCLEOSIDE KINASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCGCCCCTCTCCACAGCCGCCCCTCTCCACTGCCGCCCCTCTCCACT |
| Internal bar code: | AGCAGCTTATCGGCCATAGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 125 |
| LEAP-Seq percent confirming: | 30.7692 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAAGCGAAAATAGCGGAG |
| Suggested primer 2: | CCACTCCACCCCAATACCAC |