| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.047122 |
| Chromosome: | chromosome 17 |
| Location: | 2124331 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g711650 | NUD1,NUDC1,NUDC | (1 of 4) IPR007052//IPR008978 - CS domain // HSP20-like chaperone; Nuclear distribution/movement family protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGCATAGAGGACCCGAGCAAGCGCAAGCTGCGTGGGCGCGTGTCGGCC |
| Internal bar code: | CTTGCCGGGCGCGTGCGTGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3980 |
| LEAP-Seq percent confirming: | 84.6154 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGCGCCTCGTGATGTTGT |
| Suggested primer 2: | GTTGACAGTGACCTCGCTCA |