| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.047151 |
| Chromosome: | chromosome 17 |
| Location: | 6470314 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g744297 | (1 of 1) IPR005181//IPR013830 - Acetylesterase, domain of unknown function DUF303 // SGNH hydrolase-type esterase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATGTGTGCTAGACACACGGATGGTGCGGGCATGTGCGCTGTGCTCGC |
| Internal bar code: | CGGTCTAATTCCCTAACGTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1073 |
| LEAP-Seq percent confirming: | 98.1818 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACAACAGCACCCACCATG |
| Suggested primer 2: | AACCTCTTCCATGACTGGCG |