| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.047165 |
| Chromosome: | chromosome 13 |
| Location: | 1951381 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g576250 | (1 of 1) K15202 - general transcription factor 3C polypeptide 5 (transcription factor C subunit 1) (GTF3C5, TFC1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGGACAGTATGGGGCCTGGCTCGACAGGTTGCCGGCATGTGGGGTGAG |
| Internal bar code: | GCCGGTACCGCGGGTCTTCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1088 |
| LEAP-Seq percent confirming: | 63.1579 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCTAACAACGCAAGGGGG |
| Suggested primer 2: | ACGTCGGCACTTCACTTCAT |