Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.047174 |
Chromosome: | chromosome 16 |
Location: | 5811007 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g680050 | DRT2 | DRAP1-like protein; (1 of 1) PTHR10252:SF5 - DR1-ASSOCIATED COREPRESSOR | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACAGACCCAAGCACGCGTGGTGCCCCGGGCATGGCAACAGCCAGTGCT |
Internal bar code: | TAAGGCAGGATCCTGTAAAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 633 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATGACAGCCTCGTAGACGG |
Suggested primer 2: | CTACAGCACTCCAGTGGGTG |