Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.047252 |
Chromosome: | chromosome 8 |
Location: | 1024916 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g362100 | FAL11,FAP154 | Flagellar Associated Protein 154; (1 of 28) PTHR31600//PTHR31600:SF2 - FAMILY NOT NAMED // TINY MACROCYSTS PROTEIN B-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTGGGCCCGGTGCACTACCTGCCCGGCTGGCACCGTGACGGCCGGCCC |
Internal bar code: | CTTACGCTACATTCACTCTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5048 |
LEAP-Seq percent confirming: | 97.561 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCCACAGCCGAATCCACT |
Suggested primer 2: | TTGTCACCTTGTTTGCGCTG |