| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.047343 |
| Chromosome: | chromosome 16 |
| Location: | 1483758 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g652850 | ALG5,GTR4 | Dolichyl-phosphate beta-glucosyltransferase; (1 of 1) 2.4.1.117 - Dolichyl-phosphate beta-glucosyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCTGCTGATCATCAAGGTGGGAGGGGCACACCATGGAGGCGCACTCTC |
| Internal bar code: | AAGGATGTATATTTACCTGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3223 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCTCTGCCATTCACAGCT |
| Suggested primer 2: | TCGCCGTACATCACCGTATG |