| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.047344 |
| Chromosome: | chromosome 7 |
| Location: | 4132617 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g342550 | SMM28 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) PTHR10108:SF827 - METHYLTRANSFERASE-LIKE PROTEIN-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTTGGGCGCAAGGTCGTAAGGCAAGGCTGCCACAGCGTATGGCTTCTG |
| Internal bar code: | TTCGCATCGCTCCATTTCTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1012 |
| LEAP-Seq percent confirming: | 38.4615 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTACCTGCCGAGAAGCCTA |
| Suggested primer 2: | CCAGCAACTCCATTCCCCAT |