Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.047379 |
Chromosome: | chromosome 2 |
Location: | 57605 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g073400 | (1 of 1) K01410 - mitochondrial intermediate peptidase [EC:3.4.24.59] (MIPEP) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTACCAATACCAAGCTAATGTGTCTCTGTGTGTGTGAGCGTGTGTGTG |
Internal bar code: | TGGATTAGTGAGTCAAAGGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2403 |
LEAP-Seq percent confirming: | 62.5 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGAGCTGATGGACGACATG |
Suggested primer 2: | GGAGTTAGGCACGGGATAGC |