| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.047429 |
| Chromosome: | chromosome 12 |
| Location: | 7411467 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557300 | BLZ10 | (1 of 6) PF07716 - Basic region leucine zipper (bZIP_2); bZIP transcription factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTACTCTGTTCAGCGAAGGCCAGTGAGGCACGCGGTCGTTACCTTGGC |
| Internal bar code: | TACGTGACAGGGCACCACGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1808 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGGGACAGTACAGTGCAA |
| Suggested primer 2: | ATCAGACCCGCCAAACACAT |