| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.047554 |
| Chromosome: | chromosome 17 |
| Location: | 3678721 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g725650 | NBS | (1 of 2) K03453 - bile acid:Na+ symporter, BASS family (TC.BASS); Sodium:bile acid symporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTGCATGCCCACCTCGATGGACATGGTGCGGCACACTTTGCCGCTCA |
| Internal bar code: | AGAATCGCAACTTTAGCTGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 342 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTTCGGTTCCCTCTCCC |
| Suggested primer 2: | TGCAACGCGTTCACTTTCAG |