| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.047562 |
| Chromosome: | chromosome 12 |
| Location: | 3381476 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498100 | EIF3E | (1 of 1) K03250 - translation initiation factor 3 subunit E (EIF3E, INT6); Eukaryotic translation initiation factor 3, subunit E | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGGCCCCAGCCCCGGCGGCAACGAACCAAAACCGGGCGCAGCACCTG |
| Internal bar code: | AGGCCCCGTAGTCTGTGTGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2589 |
| LEAP-Seq percent confirming: | 83.5443 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCAATGGATTTCCTGGGG |
| Suggested primer 2: | CCTGCAATCTGGGGTCACTT |