| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.047565 |
| Chromosome: | chromosome 12 |
| Location: | 9519986 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g540250 | SELW1,SELENOW1 | Selenoprotein W1; (1 of 3) IPR011893//IPR012336 - Selenoprotein, Rdx type // Thioredoxin-like fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCATTCAGTCAGAGCAAGGTCATCCTGCAACCAGCACGTCTAAGCGG |
| Internal bar code: | GAGTCACATGCATCTCCGGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1214 |
| LEAP-Seq percent confirming: | 83.6364 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTCTGAGCCCTGTGCAT |
| Suggested primer 2: | CCAATCTTGGCGAAGATGCG |