| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.047590 |
| Chromosome: | chromosome 10 |
| Location: | 898561 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g423900 | (1 of 1) IPR001041//IPR003611 - 2Fe-2S ferredoxin-type iron-sulfur binding domain // Nuclease associated modular domain 3 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGCAAGGTGCGGGCCAGAGTCCAGAAGTTCCGGGCCAAGAAGGCCAA |
| Internal bar code: | TAAACTGAGATGGGCACGATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 785 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCTATACATGCGCCAGCT |
| Suggested primer 2: | GACGGACATCCTTTCCAGCA |