| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.047635 |
| Chromosome: | chromosome 4 |
| Location: | 1122297 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g215950 | CYN57 | Cyclophilin 57; (1 of 1) K12737 - peptidyl-prolyl cis-trans isomerase SDCCAG10 [EC:5.2.1.8] (SDCCAG10) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACTGCCGCCCCAACACACTCTACAGGTCCGCGGCGACCTGGATCACCG |
| Internal bar code: | CTTAATGGCATGATATTTAACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2533 |
| LEAP-Seq percent confirming: | 89.4737 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 76 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTGTGCCACAATCGTGAT |
| Suggested primer 2: | ATCGCGTGACGTCATAGCAT |