| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.047651 |
| Chromosome: | chromosome 16 |
| Location: | 3799846 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g688550 | GSTS1,GST1 | (1 of 3) 2.5.1.18//5.3.99.2 - Glutathione transferase / S-(hydroxyalkyl)glutathione lyase // Prostaglandin-D synthase / Prostaglandin-H(2) Delta-isomerase; Glutathione S-transferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCGCTAAGCCCACCGGCCCCGATCCTTCATTTATGCAATGCCTGCAA |
| Internal bar code: | GAAATGTCTAGAGACGGCGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1804 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACACGCCGACAGATCCTC |
| Suggested primer 2: | GTAACCTGGCACCGACATCA |