| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.047665 |
| Chromosome: | chromosome 11 |
| Location: | 2559501 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095095 | PHC12 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 12 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGTACGACTGCCGCGGCTCGCTGCAGTACATTGAGTACCAGGGCGGCA |
| Internal bar code: | GCCTGTCGACTGGAACCGCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 310 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCGGTGATCTCGTAGGTG |
| Suggested primer 2: | ACTAGCCCTTCGCCTTTGTC |