Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.047679 |
Chromosome: | chromosome 10 |
Location: | 3384380 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g443801 | (1 of 3) PF13401 - AAA domain (AAA_22) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCTGCTGCCCTCCCTCCCGCCAGACCACCACTGATTTCCCCTGCATGC |
Internal bar code: | GCTGGAAAATTTCATGTTTTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 896 |
LEAP-Seq percent confirming: | 93.75 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACACACTGCAGGTCCGTTC |
Suggested primer 2: | GAGCATTGGAGGTCGGGAAA |