| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.047693 |
| Chromosome: | chromosome 3 |
| Location: | 8345370 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g199050 | (1 of 1) IPR000595//IPR000719//IPR000961//IPR002290//IPR011009//IPR014710//IPR018490//IPR020635//IPR027916 - Cyclic nucleotide-binding domain // Protein kinase domain // AGC-kinase, C-terminal // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // RmlC-like jelly roll fold // Cyclic nucleotide-binding-like // Tyrosine-protein kinase, catalytic domain // Protein kinase-like domain, Apicomplexa | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGTTTTAGCATGTTAGCCACCGAGCCGACGCAACGCCGTGCAAGGACC |
| Internal bar code: | CATATGTGTGGGGGGTCTACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 429 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCGATATCCTTGCCGCTC |
| Suggested primer 2: | TGGGATGAGCTGGATGGAGA |