Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.047747 |
Chromosome: | chromosome 13 |
Location: | 3736871 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g588600 | KIN1-1,KIN1A | (1 of 32) 3.6.4.4 - Plus-end-directed kinesin ATPase / Kinesin; Kinesin motor protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCCCCCCCCCCGCCCCGCACATGCACATGCAGGCCAACGAGCTCAAG |
Internal bar code: | CTCCACGTTGGATTGCTAATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 115 |
LEAP-Seq percent confirming: | 20.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCAGTTGCCACAACCTCAA |
Suggested primer 2: | GGACTCGCTGATGGAGATGG |