| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.047771 |
| Chromosome: | chromosome 7 |
| Location: | 5231817 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g349152 | (1 of 2) IPR000104//IPR011598 - Antifreeze protein, type I // Myc-type, basic helix-loop-helix (bHLH) domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCATAGACGTTCCGCCACAAGAAAGAAACAATACACGTGTGAACCAC |
| Internal bar code: | TATGACACCTTTTTTATAGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4032 |
| LEAP-Seq percent confirming: | 95.2381 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCACACAACAGCAGCACAG |
| Suggested primer 2: | GGTGACTTGAGCTAGCTGCA |