| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.047783 |
| Chromosome: | chromosome 6 |
| Location: | 7666350 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g302200 | EFH3 | (1 of 1) PF13202//PF14252 - EF hand (EF-hand_5) // Domain of unknown function (DUF4347) (DUF4347); EF-hand Calcium binding protein with DUF4346 domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGGCGTGCGATGGGATAGGCAAGGGGCAGGTTGGCGGTCCTCTGCGTA |
| Internal bar code: | CCGGGTATAAGGGCGCCAACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1165 |
| LEAP-Seq percent confirming: | 38.7097 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGATGCTGACGGCGATAAT |
| Suggested primer 2: | TGACTCGCTCGACATATGGC |