| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.047786 |
| Chromosome: | chromosome 12 |
| Location: | 6620891 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g538950 | (1 of 1) PF16455 - Ubiquitin-binding domain (UBD) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCGATGGGGTCGCCGGTGGACCAAACAAGCCCACGAAACAGTACATG |
| Internal bar code: | TGGAGGACAGGGGACGGAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1797 |
| LEAP-Seq percent confirming: | 10.6667 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGATAACTGCGCCGTAT |
| Suggested primer 2: | CGCCTATCAGCTCCTGGAAG |