Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.047798 |
Chromosome: | chromosome 12 |
Location: | 1984396 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g511050 | RSP16 | Radial Spoke Protein 16; (1 of 1) K09519 - DnaJ homolog subfamily B member 13 (DNAJB13) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGAAGCGCGCCTGGCATGCTTTTCTGTCGCTTACAGCTACCGCCGGC |
Internal bar code: | GCTGCTAGGTCTTGTATGAGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1022 |
LEAP-Seq percent confirming: | 25.8065 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATCAACACCGTGCTGCACT |
Suggested primer 2: | GCCAATATGTCCAGCGCTTG |