| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.047800 |
| Chromosome: | chromosome 3 |
| Location: | 3530062 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g167600 | CaM-IP3,FAP61 | (1 of 1) PF16092 - Domain of unknown function (DUF4821) (DUF4821); Flagellar Associated Protein 61 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCAGTGTGAGGTAGTTGAACTGCAGCTCGGGGTCCAGCAGCAGCCGC |
| Internal bar code: | CGGACATCATGGGTAGCGTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2942 |
| LEAP-Seq percent confirming: | 62.069 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACTTCGGGCTCTCCAAT |
| Suggested primer 2: | GTATAGGAGCAGCGCGACAT |