Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.047825 |
Chromosome: | chromosome 12 |
Location: | 2579288 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g506650 | (1 of 1) PF07064 - RIC1 (RIC1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTGGTGGTGATGGTGGCGTGGTGGTGGTGCCGGTGTGGTGGTGGTGC |
Internal bar code: | CACTGAATGCACTTGAGTCATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1398 |
LEAP-Seq percent confirming: | 79.5455 |
LEAP-Seq n confirming: | 35 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTGTATTTGGTCGTTCGG |
Suggested primer 2: | GAGTCCCAACTTGGCACGTA |