| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.047859 |
| Chromosome: | chromosome 17 |
| Location: | 6401614 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g743897 | PRX7 | (1 of 3) K03386 - peroxiredoxin (alkyl hydroperoxide reductase subunit C) [EC:1.11.1.15] (E1.11.1.15, PRDX, ahpC); 2-cys Peroxiredoxin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCTTCACCTACCCGTCGTGCCTGACCCCCCTCCCATTTGTAATACGCA |
| Internal bar code: | GCATTGGACCCCAGAAGGATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1464 |
| LEAP-Seq percent confirming: | 76.7442 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAACACGCAACGAGCAAAG |
| Suggested primer 2: | GTGTGAGAGAGTGTCGTGCA |