| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.047954 |
| Chromosome: | chromosome 5 |
| Location: | 2696105 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre36.g759647 | (1 of 4) 3.1.3.24 - Sucrose-phosphate phosphatase / Sucrose-6-phosphate phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACATACCTGGCTGCTCCGCAGCGCCTGTCCCCGGCCGCTTGCAACTTG |
| Internal bar code: | GATGGTAGAAAATATAAACAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1688 |
| LEAP-Seq percent confirming: | 95.2381 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGTGTATGTCGTTGGTGG |
| Suggested primer 2: | TGGGTGGAGTATGAGGAGGG |