| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.047962 |
| Chromosome: | chromosome 10 |
| Location: | 164151 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g418800 | DIV156 | (1 of 7) IPR000048//IPR027417 - IQ motif, EF-hand binding site // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAAGTGGAACCAGCACCGGACAGCTGCCGAGGTCGGGTGGCTGCACCTG |
| Internal bar code: | ATTAATAGTCGTTGATTCAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4291 |
| LEAP-Seq percent confirming: | 79.661 |
| LEAP-Seq n confirming: | 47 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTAAGCTTGGAGCCACA |
| Suggested primer 2: | ACTTAGCCACGCATCCAACA |