Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.048017 |
Chromosome: | chromosome 4 |
Location: | 2336865 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g220900 | GT90-4,GT90F4 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 4 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTTGACAACGGGTGCGTAGGTGCCGGCCTGCCGGGCTGCTGGGTTGGC |
Internal bar code: | AGTTCATAGTTTTGCGTGTGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4369 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 135 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 135 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACACACAACGTACGTCCGG |
Suggested primer 2: | GCATACCGTATACGCACCCA |