| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.048017 |
| Chromosome: | chromosome 16 |
| Location: | 1393151 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g652100 | MAP2 | (1 of 1) PTHR10804//PTHR10804:SF9 - PROTEASE FAMILY M24 METHIONYL AMINOPEPTIDASE, AMINOPEPTIDASE P // METHIONINE AMINOPEPTIDASE 2; Methionine aminopeptidase | 3'UTR |
| Cre16.g652150 | FBP4 | (1 of 1) K01103 - 6-phosphofructo-2-kinase / fructose-2,6-biphosphatase 3 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGATGCGATCCTCGCTATCCCTGATGTCGGCGTCGAAGCCTCTGGGC |
| Internal bar code: | CGGTTTTCGTGTTTCGTAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2384 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 137 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 137 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGGCTTCTGGGGTAGACC |
| Suggested primer 2: | GGCCCACAAGGATGATGACA |