Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.048037 |
Chromosome: | chromosome 6 |
Location: | 2063536 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g265900 | (1 of 1) K07023 - putative hydrolases of HD superfamily (K07023) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCACAAGCCCCGGCTGAGCCTGCGTGTTAATGAGCACAAGGAAAACATT |
Internal bar code: | ACGGGTGTGTTGTTGGTCCAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 644 |
LEAP-Seq percent confirming: | 55.5556 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAAGCACAGTCTGGAGCT |
Suggested primer 2: | GGGTCCCATGATTCACAGCA |