| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.048127 |
| Chromosome: | chromosome 3 |
| Location: | 4140893 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172800 | (1 of 1) K18753 - butyrate response factor 1 (ZFP36L) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTCCTTTGTCTCTGTCAAGGGCAATGACGGCGGTGGTGGTGGTGGCGG |
| Internal bar code: | GAGAAGGTCGATGTAAAAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1715 |
| LEAP-Seq percent confirming: | 9.7561 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCGTCCATGCCACTACCC |
| Suggested primer 2: | CATCCCTGGACCAACCCATG |