| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.048138 |
| Chromosome: | chromosome 13 |
| Location: | 1695726 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g574150 | FAO10 | FAD-dependent oxidoreductase; (1 of 1) 1.1.99.2 - L-2-hydroxyglutarate dehydrogenase / L-alpha-hydroxyglutarate dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATATTCGCATAGCTGAGCACACGAACCATACATACCAGGGGAGTGGCAC |
| Internal bar code: | CCGCAACCGAAGATTTCGCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 875 |
| LEAP-Seq percent confirming: | 38.2979 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGACGCTCAACAACGCAA |
| Suggested primer 2: | GCCAACCGCCGATATCAGTA |