| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.048177 |
| Chromosome: | chromosome 16 |
| Location: | 6398871 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675350 | TPP1 | Putative tripeptidyl peptidase; (1 of 1) 3.4.14.10 - Tripeptidyl-peptidase II / Tripeptidyl peptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAATCCCTCTCCGCCGCCCTCTCAGGTGTCTGCGCCCGCCTGGTCTCGC |
| Internal bar code: | AAGAACGCAAAGACGATAAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1679 |
| LEAP-Seq percent confirming: | 91.1111 |
| LEAP-Seq n confirming: | 82 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 90 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTACCAGGCACATGCACAG |
| Suggested primer 2: | CAACCTGACCCAAAAGCACG |