Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.048198 |
Chromosome: | chromosome 2 |
Location: | 6657697 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390000 | SRH17 | SNF2-related DNA/RNA helicase; (1 of 2) K11654 - SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 [EC:3.6.4.-] (SMARCA5, SNF2H, ISWI) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCAGTCCATGGCTGTCATCCCACACGTTGCCCCCTCCACCACGCCTG |
Internal bar code: | TCGCATCTCGCTCCCTCTGGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 585 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCCAATGCCTCCTTCGAT |
Suggested primer 2: | GGAGTGGGGATGGCGTTTAA |