Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.048209 |
Chromosome: | chromosome 8 |
Location: | 4384990 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g385000 | (1 of 38) IPR000719//IPR002290//IPR011009 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCTCCGCCGCTGCGGCCGCCACGGCGGCGGCCGAGCCCAGCTGCCGGC |
Internal bar code: | AACTGAAGGGAACGACGGGGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 806 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACAGTCTCTCTTGGACGG |
Suggested primer 2: | GCATTCAACTGCTCAGCACC |