| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.048254 |
| Chromosome: | chromosome 13 |
| Location: | 3856524 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g589500 | PTK9 | Protein tyrosine kinase; (1 of 2) PTHR23257:SF428 - INACTIVE SERINE/THREONINE-PROTEIN KINASE DDB_G0280131-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGTCAGCCAAACCCCCGGCGCTAAGTGGAGTTTGCCTGCTTGGAGGCA |
| Internal bar code: | CTCCAGAATGTGAACGGCTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3042 |
| LEAP-Seq percent confirming: | 97.561 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCGCTGCTTTCCGTGATG |
| Suggested primer 2: | AGCGATGAAGCACACAGTCA |