| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.048266 |
| Chromosome: | chromosome 16 |
| Location: | 7785049 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687854 | FLA7,FAS12 | FAS1 domain containing protein;; (1 of 21) PF02469 - Fasciclin domain (Fasciclin) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAACCCCGCCGACCCGCGCAACGCCATGCGCCTGAACCGCCTCATGGC |
| Internal bar code: | TAGGCTACCGAAAAGAGCAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 604 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCACGCATGACTCACTCTT |
| Suggested primer 2: | CATCACTATCCACCTCCGCC |